WormMine: Gene WBGene00061744

• WormBase Gene ID: WBGene00061744
• Gene Name: Cre-mab-21
• Sequence Name: CRE20348
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Mab-21 domain; Mab-21 protein nucleotidyltransferase domain; and Protein 21-like 2. Is an ortholog of C. elegans mab-21. In C. elegans, mab-21 is involved in cell fate commitment; embryo development; and nematode male tail mating organ morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE20348.1	CRE20348.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE20348	CRE20348		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1104595
• Remark: Cre-mab-21, CCAGTCACTAATTACATCCTGAAGACCTTGGTATTGTACGAATGTGAGAAACACTGTAGT, WBGene00061744
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term