WormMine: Gene WBGene00061149

• WormBase Gene ID: WBGene00061149
• Gene Name: CRE16011
• Sequence Name: CRE16011
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Eukaryotic protein of unknown function (DUF829); Receptor L-domain superfamily; Receptor L-domain; Receptor L domain; and Protein of unknown function DUF829, TMEM53. Is an ortholog of C. elegans irld-29; irld-30; and irld-52.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE16011.1	CRE16011.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE16011	CRE16011		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1107708
• Remark: CRE16011, TTGGGAGTTTGGTAATAAACCCTGCAAATGAGAAAGATGTGAGCAAGTTGAAGTCAGTGG, WBGene00061149
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term