WormMine: Gene WBGene00061544

• WormBase Gene ID: WBGene00061544
• Gene Name: Cre-tim-1
• Sequence Name: CRE13386
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Timeless PAB domain; Timeless, N-terminal; Timeless protein; and Timeless, C-terminal. Is an ortholog of C. elegans tim-1. In C. elegans, tim-1 is involved in embryo development; regulation of sister chromatid cohesion; and sister chromatid cohesion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE13386.1	CRE13386.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE13386	CRE13386		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1103935
• Remark: Cre-tim-1, CGTAAAGAAGCCAACACGACAAGTGGAACGATATCTCGCTTCGATGGGCGCCAAAATCGT, WBGene00061544
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term