WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00061657 Gene Name  Cre-fsn-1
Sequence Name  ? CRE20297 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: F-box-like domain superfamily; F-box domain; Concanavalin A-like lectin/glucanase domain superfamily; and SPRY domain. Is an ortholog of C. elegans fsn-1. In C. elegans, fsn-1 is involved in several processes, including determination of adult lifespan; negative regulation of neuron projection development; and regulation of cell communication. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE20297.1 CRE20297.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE20297 CRE20297   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-fsn-1, GTTTGTGCTGTATATGGCAACACAGAAGTGACAATGGTCTACGTTGGAAGCCCCCAAATG, WBGene00061657   Expr1112923 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term