Genomics
1 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CRE13359.1 | CRE13359.1 | [unknown] |
Other
2 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Proteins expressed in activated sperm fraction after C. remanei spermatids were activated in vitro. | N.A | WBPaper00054996:activated_sperm_CRE | |
Proteins expressed in membranous oraganelle fraction after C. remanei spermatids were activated in vitro. | N.A | WBPaper00054996:membranous_oraganelle_CRE |
2 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
CRE13359, GTAACGAGAAGTATGGATACGGATACCAAGGAAAGGAGCACTCTGCCACCGCCAAGAACT, WBGene00061601 | Expr1093891 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | ||
CRE17962, CCAAGTCCAGTCAAATGTATGGGAGAGCAGAACATGTACGTGGCTCTGTGGTACAAACAC, WBGene00064148 | Expr1115320 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |