WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00061601 Gene Name  Cre-nsph-3.2
Sequence Name  ? CRE13359 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domain: Cytosolic motility protein. Is an ortholog of C. elegans nsph-3.2. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE13359.1 CRE13359.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE13359 CRE13359   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Proteins expressed in activated sperm fraction after C. remanei spermatids were activated in vitro. N.A WBPaper00054996:activated_sperm_CRE
  Proteins expressed in membranous oraganelle fraction after C. remanei spermatids were activated in vitro. N.A WBPaper00054996:membranous_oraganelle_CRE

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE13359, GTAACGAGAAGTATGGATACGGATACCAAGGAAAGGAGCACTCTGCCACCGCCAAGAACT, WBGene00061601   Expr1093891 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CRE17962, CCAAGTCCAGTCAAATGTATGGGAGAGCAGAACATGTACGTGGCTCTGTGGTACAAACAC, WBGene00064148   Expr1115320 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term