WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00128799 Gene Name  CJA09594
Sequence Name  ? CJA09594 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: EGF-like domain and EGF-like domain, extracellular. Is an ortholog of C. elegans C40H5.2. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA09594b.1 CJA09594b.1   [unknown]
Transcript:CJA09594a.1 CJA09594a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA09594b CJA09594b   [unknown]
CDS:CJA09594a CJA09594a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA09594, GCATCGTAGTATCCCGAACACGTGAAACAGTGCTAGAAGAGCTCGAAGACTCGGCAATTC, WBGene00128799   Expr1079409 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA25709, CAATATCAGCGAACGTATTCGAAAAATCCTTCCTTCAGTCGACGTGAACGCCACCAACTA, WBGene00181281   Expr1083867 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term