WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00128966 Gene Name  Cjp-osm-5
Sequence Name  ? CJA09762 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domain: Tetratricopeptide-like helical domain superfamily. Is an ortholog of C. elegans osm-5. In C. elegans, osm-5 is involved in several processes, including dauer entry; locomotory exploration behavior; and non-motile cilium assembly. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA09762a.1 CJA09762a.1   [unknown]
Transcript:CJA09762b.1 CJA09762b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA09762b CJA09762b   [unknown]
CDS:CJA09762a CJA09762a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-osm-5, CACATACGAAGATCCAGGCTTAATGTCAATGAGCCGGCCGAAAACTGGAGCCCGGAAAAC, WBGene00128966   Expr1091648 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term