WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00128837 Gene Name  Cjp-emb-30
Sequence Name  ? CJA09632 Organism  Caenorhabditis japonica
Automated Description  Is an ortholog of C. elegans emb-30. In C. elegans, emb-30 is involved in several processes, including anterior/posterior axis specification; asymmetric cell division; and metaphase/anaphase transition of meiosis I. Biotype  SO:0001217
Genetic Position 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA09632.1 CJA09632.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA09632 CJA09632   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-emb-30, AGATTGACATTTTGGATGTTAAGACAAGACAACTTGGTGTTCAGTGTCTGACAATGATGT, WBGene00128837   Expr1070771 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA22970, GATTATCAGAGACGTCGGGAAAAGTATCGAGAGGATATTGGAGGCGGAAATCTTAGCGAC, WBGene00178542   Expr1089952 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA23568, CTGCAAGTTTTACCGTCCTGCAGTAAACAGTTTGACATGGTGCTAGAGAAGAGAGGGAAC, WBGene00179140   Expr1091520 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term