WormMine: Gene WBGene00128881

• WormBase Gene ID: WBGene00128881
• Gene Name: Cjp-hmg-1.2
• Sequence Name: CJA09678
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: High mobility group box domain; High mobility group box domain superfamily; HMG-box domain; and HMG (high mobility group) box. Is an ortholog of C. elegans hmg-1.2. In C. elegans, hmg-1.2 is involved in several processes, including gonad development; positive regulation of transcription by RNA polymerase II; and vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA09678.1	CJA09678.1		[unknown]
Transcript:CJA09678.2	CJA09678.2		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA09678	CJA09678		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1083045
• Remark: Cjp-hmg-1.2, GGTGCCACAGGATACGAAGGACATGTACGAGCACAAGGCTCAAAATGACAAGGACCGATA, WBGene00128881
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term