WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00060497 Gene Name  Cre-drag-1
Sequence Name  ? CRE03915 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Repulsive guidance molecule; Mog1/PsbP, alpha/beta/alpha sandwich; Repulsive guidance molecule, N-terminal; Repulsive guidance molecule, C-terminal; Repulsive guidance molecule (RGM) C-terminus; and Repulsive guidance molecule (RGM) N-terminus. Is an ortholog of C. elegans drag-1. In C. elegans, drag-1 is involved in several processes, including mesodermal cell fate specification; regulation of BMP signaling pathway; and regulation of dauer larval development. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE03915.1 CRE03915.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE03915 CRE03915   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cre-drag-1, CTGCAGAGACCGCCGTAGAGCAGCCGAAGAAGTTTGCGGAATGTTATAATAGAAGGGTTC, WBGene00060497   Expr1117004 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term