WormMine: Gene WBGene00060564

• WormBase Gene ID: WBGene00060564
• Gene Name: CRE03947
• Sequence Name: CRE03947
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: CARP motif; Cyclase-associated protein CAP/septum formation inhibitor MinC, C-terminal; Tubulin binding cofactor C; Tubulin binding cofactor C-like domain; and TBCC domain-containing protein 1. Is an ortholog of C. elegans C54G6.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE03947.1	CRE03947.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE03947	CRE03947		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1095591
• Remark: CRE03947, CTTTCTCGACAGTCTGTTCTACACAAAATATATATTACTCGGAGCAGTTCGAGGTATTGT, WBGene00060564
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term