WormMine: Gene WBGene00060378

• WormBase Gene ID: WBGene00060378
• Gene Name: Cre-rmh-1
• Sequence Name: CRE03842
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: RecQ mediated genome instability protein; RecQ mediated genome instability protein, DUF1767; RecQ-mediated genome instability protein 1; and RecQ mediated genome instability protein, N-terminal. Is an ortholog of C. elegans rmh-1. In C. elegans, rmh-1 is involved in several processes, including DNA recombination; positive regulation of brood size; and positive regulation of reciprocal meiotic recombination.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE03842.1	CRE03842.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE03842	CRE03842		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1102628
• Remark: CRE03842, AGAAATCTCTCAATGGGTATGGGATGAGAAGAAAGGTTCGGAAGAGGAAGATGTTTCGTC, WBGene00060378
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term