WormMine: Gene WBGene00128249

• WormBase Gene ID: WBGene00128249
• Gene Name: Cjp-srx-73
• Sequence Name: CJA09045
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Serpentine type 7TM GPCR chemoreceptor Srx and 7TM GPCR, serpentine receptor class x (Srx). Is an ortholog of C. elegans srx-73.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA09045b.1	CJA09045b.1		[unknown]
Transcript:CJA09045a.1	CJA09045a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA09045a	CJA09045a		[unknown]
CDS:CJA09045b	CJA09045b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1071456
• Remark: CJA09045, GGAAAAATATCCGCTCGTTCTTCCAAACTATTCTTCAAGACTCGTTGTTTTTTGTGGATG, WBGene00128249
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term