WormMine: Gene WBGene00128241

• WormBase Gene ID: WBGene00128241
• Gene Name: Cjp-lin-7
• Sequence Name: CJA09035
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: L27 domain superfamily; L27 domain; PDZ domain; Protein lin-7; L27 domain, C-terminal; and PDZ superfamily. Is an ortholog of C. elegans lin-7. In C. elegans, lin-7 is involved in several processes, including egg-laying behavior; positive regulation of vulval development; and protein localization to basolateral plasma membrane.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA09035.1	CJA09035.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA09035	CJA09035		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1071200
• Remark: Cjp-lin-7, AACTTTTGGACGAAATGGAGCGCCGATTCGAGAGACAACGACTCCGATCCTCTCAACAAA, WBGene00128241
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term