WormMine: Gene WBGene00064607

• WormBase Gene ID: WBGene00064607
• Gene Name: Cre-pqbp-1.1
• Sequence Name: CRE31444
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: WW domain superfamily and WW domain. Is an ortholog of C. elegans pqbp-1.1. In C. elegans, pqbp-1.1 is involved in triglyceride metabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE31444.1	CRE31444.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE31444	CRE31444		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1103008
• Remark: Cre-pqbp-1.2, CAACAACGACCGTATCCGGCACCCGGAGCAATTCTAAGACGGCAGAAACCACAAGATGAT, WBGene00064607
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term