WormMine: Gene WBGene00064585

• WormBase Gene ID: WBGene00064585
• Gene Name: Cre-manf-1
• Sequence Name: CRE31424
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: SAP domain superfamily and ARMET, C-terminal. Is an ortholog of C. elegans manf-1. In C. elegans, manf-1 is involved in developmental growth and regulation of response to endoplasmic reticulum stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE31424.1	CRE31424.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE31424	CRE31424		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1096095
• Remark: CRE31424, AGAAGATGCGCGTGAAGGAGCTCAAAAACATTCTTGGCGAGTGGGGAGAGTCGTGCAAAG, WBGene00064585
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term