WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00064560 Gene Name  Cre-aass-1
Sequence Name  ? CRE31349 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Alanine dehydrogenase/pyridine nucleotide transhydrogenase, N-terminal; Saccharopine dehydrogenase, NADP binding domain; Saccharopine dehydrogenase NADP binding domain; Alanine dehydrogenase/PNT, N-terminal domain; NAD(P)-binding domain superfamily; Alanine dehydrogenase/pyridine nucleotide transhydrogenase, NAD(H)-binding domain; Saccharopine dehydrogenase C-terminal domain; and Saccharopine dehydrogenase-like, C-terminal. Is an ortholog of C. elegans aass-1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE31349a.1 CRE31349a.1   [unknown]
Transcript:CRE31349b.1 CRE31349b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE31349a CRE31349a   [unknown]
CDS:CRE31349b CRE31349b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE31349, TATTGTATCGCATATGGTGCTGAACAACGAGATTCAACGAGCCGGAATTCAACGTCCAAT, WBGene00064560   Expr1105890 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term