WormMine: Gene WBGene00064560

• WormBase Gene ID: WBGene00064560
• Gene Name: Cre-aass-1
• Sequence Name: CRE31349
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Alanine dehydrogenase/pyridine nucleotide transhydrogenase, N-terminal; Saccharopine dehydrogenase, NADP binding domain; Saccharopine dehydrogenase NADP binding domain; Alanine dehydrogenase/PNT, N-terminal domain; NAD(P)-binding domain superfamily; Alanine dehydrogenase/pyridine nucleotide transhydrogenase, NAD(H)-binding domain; Saccharopine dehydrogenase C-terminal domain; and Saccharopine dehydrogenase-like, C-terminal. Is an ortholog of C. elegans aass-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE31349a.1	CRE31349a.1		[unknown]
Transcript:CRE31349b.1	CRE31349b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE31349a	CRE31349a		[unknown]
CDS:CRE31349b	CRE31349b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1105890
• Remark: CRE31349, TATTGTATCGCATATGGTGCTGAACAACGAGATTCAACGAGCCGGAATTCAACGTCCAAT, WBGene00064560
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term