WormMine: Gene WBGene00063555

• WormBase Gene ID: WBGene00063555
• Gene Name: CRE21230
• Sequence Name: CRE21230
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Damage-control phosphatase ARMT1-like domain; Protein-glutamate O-methyltransferase; AF1104-like superfamily; and Damage-control phosphatase ARMT1-like, metal-binding domain. Is an ortholog of C. elegans F31D4.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE21230.1	CRE21230.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE21230	CRE21230		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1110256
• Remark: CRE21230, AAAATATGGAGATAATTTTCAAGTGTGATCTCTTCTGGATCTCACCACACCCCTACTATA, WBGene00063555
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term