WormMine: Gene WBGene00063598

• WormBase Gene ID: WBGene00063598
• Gene Name: CRE21200
• Sequence Name: CRE21200
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Ubiquitin-like domain superfamily; Ubiquitin domain; Ubiquitin family; and Ubiquitin-like domain. Is an ortholog of C. elegans ned-8. In C. elegans, ned-8 is involved in negative regulation of DNA damage response, signal transduction by p53 class mediator; negative regulation of gene expression; and regulation of apoptotic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE21200.1	CRE21200.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE21200	CRE21200		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1106757
• Remark: CRE21200, ACCGGAAAAGAAATCGAGTTGGACATTGAAGGGAACGATCGCGTGGAGAGAATCAAGGAG, WBGene00063598
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term