WormMine: Gene WBGene00066349

• WormBase Gene ID: WBGene00066349
• Gene Name: Cre-let-653
• Sequence Name: CRE15469
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: PAN/Apple domain; Zona pellucida domain; and PAN domain. Is an ortholog of C. elegans let-653. In C. elegans, let-653 is involved in several processes, including cuticle pattern formation; embryonic ectodermal digestive tract morphogenesis; and regulation of developmental process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE15469.1	CRE15469.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE15469	CRE15469		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1103550
• Remark: Cre-let-653, CTGTGATGACGTTGAAGGTTGTGACAGCAGCTATATGCATAGATACAGAAGGGAATTGTC, WBGene00066349
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term