WormMine: Gene WBGene00033281

• WormBase Gene ID: WBGene00033281
• Gene Name: Cbr-frm-4
• Sequence Name: CBG12316
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: FERM/acyl-CoA-binding protein superfamily; FERM N-terminal domain; Band 4.1 domain; FERM C-terminal PH-like domain; FERM, C-terminal PH-like domain; FERM, N-terminal; FERM superfamily, second domain; Ubiquitin-like domain superfamily; FERM central domain; and PH-like domain superfamily. Is an ortholog of C. elegans frm-4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

6 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12316f.1	CBG12316f.1		[unknown]
Transcript:CBG12316c.1	CBG12316c.1		[unknown]
Transcript:CBG12316d.1	CBG12316d.1		[unknown]
Transcript:CBG12316e.1	CBG12316e.1		[unknown]
Transcript:CBG12316a.1	CBG12316a.1		[unknown]
Transcript:CBG12316b.1	CBG12316b.1		[unknown]

Other

6 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12316a	CBG12316a		[unknown]
CDS:CBG12316b	CBG12316b		[unknown]
CDS:CBG12316e	CBG12316e		[unknown]
CDS:CBG12316f	CBG12316f		[unknown]
CDS:CBG12316c	CBG12316c		[unknown]
CDS:CBG12316d	CBG12316d		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064906
• Remark: Cbr-frm-4, ACGAACCAACTCGTCATTATGTAGTTGGACAGTACCGGAAGTATTTCGGGCCAAAAATCT, WBGene00033281
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term