WormMine: Gene WBGene00065421

• WormBase Gene ID: WBGene00065421
• Gene Name: Cre-lin-10
• Sequence Name: CRE20420
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: PDZ domain; Phosphotyrosine interaction domain (PTB/PID); PTB/PI domain; PDZ superfamily; and PH-like domain superfamily. Is an ortholog of C. elegans lin-10. In C. elegans, lin-10 is involved in several processes, including neuron-neuron synaptic transmission; positive regulation of backward locomotion; and protein localization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE20420.1	CRE20420.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE20420	CRE20420		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1102190
• Remark: Cre-lin-10, GAATCGCGGAACGAGGTGGAATCCGTGTGGGTCATCGAATCATCGAAATCAACGGGACGT, WBGene00065421
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term