WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00024167 Gene Name  CBG00837
Sequence Name  ? CBG00837 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Alpha/beta hydrolase of unknown function (DUF1057); Alpha/Beta hydrolase fold; and Protein of unknown function DUF1057. Is an ortholog of C. elegans F10D2.10. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG00837.1 CBG00837.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG00837 CBG00837   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG00837, TGGTTGCAGAGGTGGTCAGAAAGATTCTAGACTTGGATGGTGTGAAGAAGAACAAGCTGT, WBGene00024167   Expr1056380 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term