WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00068619 Gene Name  CRE19341
Sequence Name  ? CRE19341 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Immunoglobulin I-set domain; Immunoglobulin I-set; Immunoglobulin subtype; Immunoglobulin-like fold; Immunoglobulin subtype 2; and Immunoglobulin-like domain superfamily. Is an ortholog of C. elegans F21C10.7. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE19341.1 CRE19341.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE19341 CRE19341   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE19341, GTGCAGATAGTGGACAATTCACATGCCTCGCTGAAAATATTGCTGGAGAAGCCCGATCCA, WBGene00068619   Expr1104127 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CRE29258, ATCAGGAGCAGTTTGAGCATTTGAGACGGAAGATTGAAGACTTGAAAGTGGAAGTGGAGA, WBGene00073303   Expr1095832 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term