WormMine: Gene WBGene00024103

• WormBase Gene ID: WBGene00024103
• Gene Name: Cbr-sup-37
• Sequence Name: CBG00762
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: Zinc finger C2H2-type. Is an ortholog of C. elegans sup-37. In C. elegans, sup-37 is involved in embryonic digestive tract morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00762b.1	CBG00762b.1		[unknown]
Transcript:CBG00762a.1	CBG00762a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00762b	CBG00762b		[unknown]
CDS:CBG00762a	CBG00762a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054542
• Remark: CBG00762, GATCAGATGGAGAATCATCAGTCGAAGGCTCACGGGCGGATTGACCCGGATATGATGGAG, WBGene00024103
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term