WormMine: Gene WBGene00068410

• WormBase Gene ID: WBGene00068410
• Gene Name: CRE16296
• Sequence Name: CRE16296
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Fibrinogen, alpha/beta/gamma chain, C-terminal globular domain; Fibrinogen beta and gamma chains, C-terminal globular domain; and Fibrinogen-like, C-terminal. Is an ortholog of C. elegans C49C8.5. In C. elegans, C49C8.5 is involved in innate immune response.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE16296.1	CRE16296.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE16296	CRE16296		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Proteins expressed in activated sperm fraction after C. remanei spermatids were activated in vitro.	N.A	WBPaper00054996:activated_sperm_CRE

1 Expression Patterns

• Primary Identifier: Expr1100661
• Remark: CRE16296, TCAAACTATTTACCCAGACGGTTCTAGTCCTGTTAACGTTTATTGTGACCAGAAATCAGC, WBGene00068410
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term