WormMine: Gene WBGene00068234

• WormBase Gene ID: WBGene00068234
• Gene Name: CRE02557
• Sequence Name: CRE02557
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Smr domain superfamily; 7TM GPCR, serpentine receptor class r (Str); Smr domain; and Serpentine type 7TM GPCR chemoreceptor Str. Is an ortholog of C. elegans T23F1.3; str-76; and str-74.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE02557.1	CRE02557.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE02557	CRE02557		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1102336
• Remark: CRE02557, AAAGGCAAAAAGTTCAACGAATCCAGATCCCCACCGAATCGCTACGATCTCCATTACCTG, WBGene00068234
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term