WormMine: Gene WBGene00068135

• WormBase Gene ID: WBGene00068135
• Gene Name: CRE23640
• Sequence Name: CRE23640
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Aconitase family (aconitate hydratase); Aconitase, iron-sulfur domain; Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 1/3; and Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha domain.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE23640.1	CRE23640.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE23640	CRE23640		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1096310
• Remark: CRE23640, GTACCATGCATTGGACAATGGGATCGTCAAGATGTGAAGAAGAGAGAGAGAGAGGAGCAC, WBGene00068135
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term