WormMine: Gene WBGene00067053

• WormBase Gene ID: WBGene00067053
• Gene Name: Cre-odr-8.1
• Sequence Name: CRE24676
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Papain-like cysteine peptidase superfamily; Peptidase family C78; and Peptidase C78, ubiquitin fold modifier-specific peptidase 1/ 2. Is an ortholog of C. elegans odr-8. In C. elegans, odr-8 is involved in several processes, including positive regulation of chemotaxis; protein localization to non-motile cilium; and response to ethanol.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE24676.1	CRE24676.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE24676	CRE24676		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1104329
• Remark: CRE24676, CATACAACTATCATCATTACATGCAAGACGGAATTGATGACAACGGATGGGGATGTGCTT, WBGene00067053
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term