WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00213703 Gene Name  CJA37856
Sequence Name  ? CJA37856 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Armadillo-type fold and Armadillo-like helical. Is an ortholog of C. elegans cls-1. In C. elegans, cls-1 is involved in microtubule cytoskeleton organization and positive regulation of microtubule depolymerization. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA37856.1 CJA37856.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA37856 CJA37856   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA05659, TTGGTTGCGTTGGTTCAAAGAATCGGAATGGCAAGGATGGAGAAGCATTTGAAGTCGTTG, WBGene00124863   Expr1080351 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term