WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00072566 Gene Name  CRE15021
Sequence Name  ? CRE15021 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domain: CUB-like domain. Is an ortholog of C. elegans F35E12.6; dct-17; and irg-5. In C. elegans, irg-5 is involved in defense response to Gram-positive bacterium. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE15021.1 CRE15021.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE15021 CRE15021   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE15021, CGATCACCGGTCAGCAACTATTGCTGGAACAGGAATACGACTCTCCTTCGAAATTCAAAA, WBGene00072566   Expr1114680 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CRE02502, TGTTGAATTTTGAGATGATAGATATGACAGAGACTACTGTATCGATGGAGACCACAACAA, WBGene00068261   Expr1106900 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term