WormMine: Gene WBGene00028346

• WormBase Gene ID: WBGene00028346
• Gene Name: CBG06000
• Sequence Name: CBG06000
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, C2H2 type; Zinc finger C2H2-type; and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans Y5F2A.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06000a.1	CBG06000a.1		[unknown]
Transcript:CBG06000b.1	CBG06000b.1		[unknown]
Transcript:CBG06000b.2	CBG06000b.2		[unknown]
Transcript:CBG06000c.1	CBG06000c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06000a	CBG06000a		[unknown]
CDS:CBG06000b	CBG06000b		[unknown]
CDS:CBG06000c	CBG06000c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061504
• Remark: CBG06000, TGTGTCGAATGACTATACGAGTTCCCGTAAGCATTCCACAATCTTGCGACAACGAACAAA, WBGene00028346
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term