WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00028419 Gene Name  Cbr-magi-1
Sequence Name  ? CBG06086 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: PDZ domain and PDZ superfamily. Is an ortholog of C. elegans magi-1. In C. elegans, magi-1 is involved in habituation; long-term memory; and regulation of protein localization. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG06086a.1 CBG06086a.1   [unknown]
Transcript:CBG06086b.1 CBG06086b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG06086a CBG06086a   [unknown]
CDS:CBG06086b CBG06086b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG06087, CGGATATTGGAGGATATGATGCGAGAGCATGATCAGATTGCTATAGAAATACTTCCAGCT, WBGene00028420   Expr1058936 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cbr-magi-1, AAGGGATTCGGGTTCTCAATTCGCGGCGGACAAGAATTCGGAGCGATGCCACTTTTCGTT, WBGene00028419   Expr1056523 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term