WormMine: Gene WBGene00207793

• WormBase Gene ID: WBGene00207793
• Gene Name: Cjp-tmed-13.1
• Sequence Name: CJA31946
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Transmembrane emp24 domain-containing protein; emp24/gp25L/p24 family/GOLD; and GOLD domain. Is an ortholog of C. elegans tmed-13.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA31946b.1	CJA31946b.1		[unknown]
Transcript:CJA31946a.1	CJA31946a.1		[unknown]
Transcript:CJA31946c.1	CJA31946c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA31946a	CJA31946a		[unknown]
CDS:CJA31946b	CJA31946b		[unknown]
CDS:CJA31946c	CJA31946c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1080573
• Remark: CJA03877, AATCACTTTATCGATCGACGAGAAGCTTCAAATCATGAAGACCGAGCAGGCGAAACGGGC, WBGene00123081
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term