WormMine: Gene WBGene00070907

• WormBase Gene ID: WBGene00070907
• Gene Name: CRE08542
• Sequence Name: CRE08542
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Ribonuclease Zc3h12a-like, NYN domain; MATH domain; MATH/TRAF domain; BTB/POZ domain; TRAF-like; Zc3h12a-like Ribonuclease NYN domain; and SKP1/BTB/POZ domain superfamily. Is an ortholog of C. elegans Y51H4A.13; Y24D9B.1; and sdz-18.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE08542.1	CRE08542.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE08542	CRE08542		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1106796
• Remark: CRE08542, TCAAAATTGGCAGTTCTCGTCGAGAAGTGTCTTGTTGAGCCGGATGAGGACGGTGATGGT, WBGene00070907
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term