WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00069122 Gene Name  Cre-eor-1
Sequence Name  ? CRE19458 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Zinc finger, C2H2 type; Zinc finger C2H2-type; and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans eor-1. In C. elegans, eor-1 is involved in several processes, including determination of adult lifespan; nematode male tail tip morphogenesis; and signal transduction. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE19458.1 CRE19458.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE19458 CRE19458   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE03596, TCATCTGGAAGAGAAACCATTCAAATGTGATCAATGTGAATACGCGTCGAGTCGAAGGGA, WBGene00075170   Expr1108193 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CRE26926, CCCTTCTCTCTCCCAACTTACGGTCAAATGGATATGGCTCAATCTCAATTGCAACAACAA, WBGene00082279   Expr1117911 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term