WormMine: Gene WBGene00035601

• WormBase Gene ID: WBGene00035601
• Gene Name: Cbr-trpp-11
• Sequence Name: CBG15291
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Trafficking protein particle complex subunit 11 and Foie gras liver health family 1. Is an ortholog of C. elegans trpp-11.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15291b.1	CBG15291b.1		[unknown]
Transcript:CBG15291a.1	CBG15291a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15291b	CBG15291b		[unknown]
CDS:CBG15291a	CBG15291a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052621
• Remark: CBG15291, GCCGTGTTGTTCGTGGAAAAGGATGGAAATGAGCTGAAATCCGAGTTTTCGATGACAATT, WBGene00035601
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term