WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00136103 Gene Name  Cjp-aakb-1
Sequence Name  ? CJA16899 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Immunoglobulin E-set; AMP-activated protein kinase, glycogen-binding domain; 5'-AMP-activated protein kinase beta subunit, interaction domain; ASC domain superfamily; Immunoglobulin-like fold; Association with the SNF1 complex (ASC) domain; and Glycogen recognition site of AMP-activated protein kinase. Is an ortholog of C. elegans aakb-1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA16899.2 CJA16899.2   [unknown]
Transcript:CJA16899.1 CJA16899.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA16899 CJA16899   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-aakb-1, TCAGCGACTCATCGTTACCGTAAGAAGTTTGTGACCACTTTGCTCTATAAACCTATCAAT, WBGene00136103   Expr1083241 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term