WormMine: Gene WBGene00138601

• WormBase Gene ID: WBGene00138601
• Gene Name: CJA19397
• Sequence Name: CJA19397
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: WD40/YVTN repeat-like-containing domain superfamily; Kelch-type beta propeller; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans W09G3.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA19397a.1	CJA19397a.1		[unknown]
Transcript:CJA19397c.1	CJA19397c.1		[unknown]
Transcript:CJA19397b.1	CJA19397b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA19397b	CJA19397b		[unknown]
CDS:CJA19397a	CJA19397a		[unknown]
CDS:CJA19397c	CJA19397c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070384
• Remark: CJA19397, GTATCCTATTGTTGTGGTCACGTTTACCATAAAGTTTGCCTTGCCGGTCGATACACGATC, WBGene00138601
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term