WormMine: Gene WBGene00070533

• WormBase Gene ID: WBGene00070533
• Gene Name: CRE07027
• Sequence Name: CRE07027
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: GRAM domain; Membrane-anchored lipid-binding protein Ysp2/Lam4-like; VASt domain; VAD1 Analog of StAR-related lipid transfer domain; and PH-like domain superfamily. Is an ortholog of C. elegans ZC328.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE07027.1	CRE07027.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE07027	CRE07027		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1111379
• Remark: CRE07027, GTTGTGAAGGGATTCGTTGAGAAGGGCACTTTCAGTGCTTTGGATGAGCATTATAAGATT, WBGene00070533
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term