WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00035604 Gene Name  CBG15297
Sequence Name  ? CBG15297 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: N-acetyltransferase ESCO, zinc-finger; ESCO1/2 acetyl-transferase; N-acetyltransferase ESCO, acetyl-transferase domain; zinc-finger of acetyl-transferase ESCO; and N-acetyltransferase Eco1/Protein CHROMOSOME TRANSMISSION FIDELITY 7. Is an ortholog of C. elegans F08F8.4. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG15297b.1 CBG15297b.1   [unknown]
Transcript:CBG15297a.1 CBG15297a.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG15297a CBG15297a   [unknown]
CDS:CBG15297b CBG15297b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG15297, GCAATGCATGATAAATACCACGAAGCGATGCGATTCCTATTCGAGATTCCACGGGAATTC, WBGene00035604   Expr1056867 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term