WormMine: Gene WBGene00209416

• WormBase Gene ID: WBGene00209416
• Gene Name: CJA33569
• Sequence Name: CJA33569
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: P-loop containing nucleoside triphosphate hydrolase; Helicase-associated domain; and Helicase associated domain (HA2).
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA33569.1	CJA33569.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA33569	CJA33569		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1075214
• Remark: Cjp-mog-1, TTCTGCGAAATGGTGTGCGGACAATTATCTGCATGTGAAGGCGTTGAAAAAGGTTCGAGA, WBGene00123002
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term