WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00029112 Gene Name  CBG06924
Sequence Name  ? CBG06924 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domain: F-box protein she-1-like. Is an ortholog of C. elegans F46B3.16. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG06924c.2 CBG06924c.2   [unknown]
Transcript:CBG06924c.1 CBG06924c.1   [unknown]
Transcript:CBG06924b.1 CBG06924b.1   [unknown]
Transcript:CBG06924a.1 CBG06924a.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG06924a CBG06924a   [unknown]
CDS:CBG06924b CBG06924b   [unknown]
CDS:CBG06924c CBG06924c   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG06924, GATTTCCAACAGAATCCACCCATACGAGAGTCTCACTTTGCAAATTACGGATTTCGAAGA, WBGene00029112   Expr1055281 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term