WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00031042 Gene Name  Cbr-pqn-22
Sequence Name  ? CBG09470 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domain: Zasp-like motif. Is an ortholog of C. elegans pqn-22. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

5 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG09470e.1 CBG09470e.1   [unknown]
Transcript:CBG09470d.1 CBG09470d.1   [unknown]
Transcript:CBG09470a.1 CBG09470a.1   [unknown]
Transcript:CBG09470c.1 CBG09470c.1   [unknown]
Transcript:CBG09470b.1 CBG09470b.1   [unknown]
 

Other

5 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG09470a CBG09470a   [unknown]
CDS:CBG09470b CBG09470b   [unknown]
CDS:CBG09470c CBG09470c   [unknown]
CDS:CBG09470d CBG09470d   [unknown]
CDS:CBG09470e CBG09470e   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-pqn-22, TTTCCAACCAAAAGATCCGTCATGAGGTCCGTCACATCGACCAGACCAAATTCGGAACAT, WBGene00031042   Expr1070005 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term