WormMine: Gene WBGene00130608

• WormBase Gene ID: WBGene00130608
• Gene Name: Cjp-cutl-23
• Sequence Name: CJA11404
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: von Willebrand factor, type A; Zona pellucida domain; von Willebrand factor type A domain; and von Willebrand factor A-like domain superfamily. Is an ortholog of C. elegans cutl-23.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA11404c.1	CJA11404c.1		[unknown]
Transcript:CJA11404b.1	CJA11404b.1		[unknown]
Transcript:CJA11404a.1	CJA11404a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA11404a	CJA11404a		[unknown]
CDS:CJA11404b	CJA11404b		[unknown]
CDS:CJA11404c	CJA11404c		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1075928
• Remark: Cjp-cutl-23, ATGTACGCGCACAATTATCACGACGAGCCGGATTGTATGATACGAAAGACGGATAATAGC, WBGene00130608
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term