WormMine: Gene WBGene00036539

• WormBase Gene ID: WBGene00036539
• Gene Name: Cbr-fbxl-1
• Sequence Name: CBG16659
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Leucine Rich repeat; F-box-like; Leucine-rich repeat; Leucine Rich Repeat; Leucine-rich repeat domain superfamily; F-box domain; and Leucine-rich repeat, cysteine-containing subtype. Is an ortholog of C. elegans fbxl-1. In C. elegans, fbxl-1 is involved in several processes, including dauer entry; defecation rhythm; and regulation of defecation rhythm.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG16659.1	CBG16659.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG16659	CBG16659		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068469
• Remark: CBG16659, GTCTATCCAGAATCTTGCCACAAAACACCGAGATACTCTGAATGTTCTGGAACTTGACAA, WBGene00036539
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term