WormMine: Gene WBGene00131051

• WormBase Gene ID: WBGene00131051
• Gene Name: CJA11847
• Sequence Name: CJA11847
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: FERM N-terminal domain; PTB/PI domain; FERM, N-terminal; Ubiquitin-like domain superfamily; and PH-like domain superfamily. Is an ortholog of C. elegans M88.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA11847b.1	CJA11847b.1		[unknown]
Transcript:CJA11847a.1	CJA11847a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA11847a	CJA11847a		[unknown]
CDS:CJA11847b	CJA11847b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1091834
• Remark: CJA11847, TACGAATCAGAAAAACGAGCGTCACTTTCCGAACTGCCAATAGAAACCGATTCGACACGG, WBGene00131051
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term