WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00130156 Gene Name  Cjp-gcn-1
Sequence Name  ? CJA10952 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Armadillo-type fold; HEAT repeat; Translational activator Gcn1; Armadillo-like helical; and TOG domain. Is an ortholog of C. elegans gcn-1. In C. elegans, gcn-1 is involved in positive regulation of peptidyl-serine phosphorylation; regulation of apoptotic process; and regulation of translation. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA10952.1 CJA10952.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA10952 CJA10952   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

3 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA07449, CTAACCGCACTTTTCAAGACGGCAGAAGCAAAACTGGATGAAACGCGCGCGATGGTGATC, WBGene00126653   Expr1086250 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Cjp-gcn-1, GCGCAAATCATCAGCAACATTTACTCGCTCACCGAGAACAAGGACATGGAGCCGTATCTG, WBGene00130156   Expr1075824 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA01505, GAATGATGTGCTGAAGCTGATGGTGCCACAGTTGGTGAACGGGTGCAAAGAGAGCAATTC, WBGene00120709   Expr1076724 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term