WormMine: Gene WBGene00130041

• WormBase Gene ID: WBGene00130041
• Gene Name: Cjp-wdr-5.1
• Sequence Name: CJA10837
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: G-protein beta WD-40 repeat; WD40/YVTN repeat-like-containing domain superfamily; WD40 repeat; WD domain, G-beta repeat; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans wdr-5.1. In C. elegans, wdr-5.1 is involved in determination of adult lifespan; programmed cell death; and transdifferentiation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA10837.1	CJA10837.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA10837	CJA10837		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1082108
• Remark: Cjp-swd-3.1, GGAAGACGCCAAGATTTACATCTGGAACCTGCAGACGAAGGAGATAGTTCAACAGCTTGA, WBGene00130041
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term