WormMine: Gene WBGene00130570

• WormBase Gene ID: WBGene00130570
• Gene Name: Cjp-spp-5
• Sequence Name: CJA11366
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Saposin B type domain; Saposin B type, region 2; Saposin-like type B, region 2; and Saposin-like. Is an ortholog of C. elegans spp-5. In C. elegans, spp-5 is involved in defense response to Gram-negative bacterium and defense response to Gram-positive bacterium.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA11366.1	CJA11366.1		[unknown]
Transcript:CJA11366.2	CJA11366.2		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA11366	CJA11366		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1077402
• Remark: Cjp-spp-5, ATCAAGGAGCTCGAAGGAGGAACTGCTCCAAAGGACGTGTGCACTAAACTTAACGAGTGC, WBGene00130570
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term